2018-07-26 13:04:282025-05-22 13:04:24
description
glucose permease, trigger enzyme
glucose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICBA of the [[category|Phosphotransferase system|PTS]], [[category|Trigger enzyme]], control of [[protein|GlcT]] activity
locus
BSU13890
BSU_13890
geneLength
2097
2100
outlinks
bsu
BSU13890
BSU_13890
The protein
Catalyzed reaction/ biological activity
transport and phosphorylation of glucose, receives a phosphate from [[protein|PtsH|HPr]]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [[protein|GlcT]].
transport and phosphorylation of glucose, receives a phosphate from [[protein|PtsH|HPr]]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [[protein|GlcT]].
D-glucose + Nπ-phospho-L-histidyl-[protein] --> D-glucose 6-phosphate + L-histidyl-[protein] (according to UniProt)
The protein
Protein family
[[protein|PtsI]] permease, glucose permease (Glc) family [Pubmed|10627040], [[protein|PtsI]] enzyme II
[[category|Phosphotransferase system|PTS]] permease, glucose family [Pubmed|10627040]
The protein
[SW|Domains]
11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
PTS EIIC domain ( 1-424)
PTS EIIB domain (439–520)
PTS EIIA domain (568–672)
11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
[SW|PTS EIIA domain] type-1 (aa 568–672) (according to UniProt)
[SW|PTS EIIB domain] type-1 (aa 439–520) (according to UniProt)
[SW|PTS EIIC domain] type-1 (aa 1-424) (according to UniProt)
Biological materials
Mutant
BKE13890 (Δ[[gene|ptsG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
BKK13890 (Δ[[gene|ptsG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928], available in [SW|Jörg Stülke]'s lab
BKE13890 (Δ[[gene|ptsG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
BKK13890 (Δ[[gene|ptsG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
Biological materials
Expression vector
pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
Biological materials
lacZ fusion
pGP34 ([[protein|pAC5]]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
pGP66 ([[protein|pAC7]]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
pGP606 (mutant terminator, [[protein|pAC6]]), available in [SW|Jörg Stülke]'s lab
pGP532 ([[protein|pAC7]]), available in [SW| Jörg Stülke]'s lab
series of promoter deletions are available in [[protein|pAC5]] and [[protein|pAC6]], available in [SW|Jörg Stülke]'s lab
series of RAT mutants are available in [[protein|pAC6]], available in [SW|Jörg Stülke]'s lab
pGP34 ([SW|pAC5]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
pGP66 ([SW|pAC7]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
pGP606 (mutant terminator, [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
pGP532 ([SW|pAC7]), available in [SW| Jörg Stülke]'s lab
series of promoter deletions are available in [SW|pAC5] and [SW|pAC6], available in [SW|Jörg Stülke]'s lab
series of RAT mutants are available in [SW|pAC6], available in [SW|Jörg Stülke]'s lab
Labs working on this gene/protein
[SW|Jörg Stülke], University of Göttingen, Germany
[http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
References
Original publications
The protein
Paralogous protein(s)
[[this]]
Biological materials
Expression vectors
pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
labs
[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]