SubtiBank SubtiBank
Version comparison:

2018-07-26 13:04:282025-05-22 13:04:24

description

glucose permease, trigger enzyme

glucose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICBA of the [[category|Phosphotransferase system|PTS]], [[category|Trigger enzyme]], control of [[protein|GlcT]] activity

locus

BSU13890

BSU_13890

geneLength

2097

2100

outlinks

bsu

BSU13890

BSU_13890

The protein

Catalyzed reaction/ biological activity

transport and phosphorylation of glucose, receives a phosphate from [[protein|PtsH|HPr]]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [[protein|GlcT]].

transport and phosphorylation of glucose, receives a phosphate from [[protein|PtsH|HPr]]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [[protein|GlcT]].

D-glucose + Nπ-phospho-L-histidyl-[protein] --> D-glucose 6-phosphate + L-histidyl-[protein] (according to UniProt)

The protein

Protein family

[[protein|PtsI]] permease, glucose permease (Glc) family [Pubmed|10627040], [[protein|PtsI]] enzyme II

[[category|Phosphotransferase system|PTS]] permease, glucose family [Pubmed|10627040]

The protein

[SW|Domains]

11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)

PTS EIIC domain ( 1-424)

PTS EIIB domain (439–520)

PTS EIIA domain (568–672)

11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)

[SW|PTS EIIA domain] type-1 (aa 568–672) (according to UniProt)

[SW|PTS EIIB domain] type-1 (aa 439–520) (according to UniProt)

[SW|PTS EIIC domain] type-1 (aa 1-424) (according to UniProt)

Biological materials

Mutant

BKE13890 (Δ[[gene|ptsG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

BKK13890 (Δ[[gene|ptsG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

GP778 (Δ[[gene|glcT]]-[[gene|ptsG]]-[[gene|ptsH]]-[[gene|ptsI]]::spc) [Pubmed|22722928], available in [SW|Jörg Stülke]'s lab

BKE13890 (Δ[[gene|ptsG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

BKK13890 (Δ[[gene|ptsG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

Biological materials

Expression vector

pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab

Biological materials

lacZ fusion

pGP34 ([[protein|pAC5]]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab

pGP66 ([[protein|pAC7]]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab

pGP606 (mutant terminator, [[protein|pAC6]]), available in [SW|Jörg Stülke]'s lab

pGP532 ([[protein|pAC7]]), available in [SW| Jörg Stülke]'s lab

series of promoter deletions are available in [[protein|pAC5]] and [[protein|pAC6]], available in [SW|Jörg Stülke]'s lab

series of RAT mutants are available in [[protein|pAC6]], available in [SW|Jörg Stülke]'s lab

pGP34 ([SW|pAC5]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab

pGP66 ([SW|pAC7]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab

pGP606 (mutant terminator, [SW|pAC6]), available in [SW|Jörg Stülke]'s lab

pGP532 ([SW|pAC7]), available in [SW| Jörg Stülke]'s lab

series of promoter deletions are available in [SW|pAC5] and [SW|pAC6], available in [SW|Jörg Stülke]'s lab

series of RAT mutants are available in [SW|pAC6], available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

[SW|Jörg Stülke], University of Göttingen, Germany

[http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

References

Original publications

10627040, 12850135, 18763711, 11902727, 9765562, 9513271, 1956301, 10543968, 17074746, 15155854, 14527945, 1508157, 2120236, 9593197, 8418852, 1581296, 1316146, 1733770, 1942043, 1911744, 1906345, 20081037, 22846916, 1447219, 27161976, 9593197

10627040, 12850135, 18763711, 11902727, 9765562, 9513271, 1956301, 10543968, 17074746, 15155854, 14527945, 1508157, 2120236, 9593197, 8418852, 1581296, 1316146, 1733770, 1942043, 1911744, 1906345, 20081037, 22846916, 1447219, 27161976, 9593197, 30038046, 31740237

The protein

Paralogous protein(s)

[[this]]

Biological materials

Expression vectors

pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab

labs

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]